Quick Order

Human PVRL3 / PRR3 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PVRL3 cDNA Clone Product Information
Gene_bank_ref_id:NM_015480.1
RefSeq ORF Size:1566bp
cDNA Description:Full length Clone DNA of Homo sapiens poliovirus receptor-related 3 with C terminal HA tag.
Gene Synonym:PPR3, PRR3, CD113, PVRR3, CDw113, FLJ90624, nectin-3, DKFZp566B0846, PVRL3
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Poliovirus receptor-related 3 (PVRL3), also known as Nectin-3 and CD113, is a member of the nectin family. PVRL3/Nectin-3 is an 83 kDa, type I transmembrane glycoprotein. Its precursor is 549 amino acids (aa) in length and contains an extended signal sequence of 57 aa, an extracellular domain (ECD) of 347 aa, a transmembrane segment of 21 aa, and a cytoplasmic region of 124 aa. Nectin-3 has three splicing variants, nectin-3alpha (biggest), -3beta (middle), and -3gamma (smallest). It is predominantly expressed in testis and placenta as well as in various cell lines, including epithelial cell lines. PVRL3/Nectin-3 plays a role in cell-cell adhesion through heterophilic trans-interactions with nectin-like proteins or nectins, such as trans-interaction with PVRL2/Nectin-2 at Sertoli-spermatid junctions. PVRL3/Nectin-3 is thus involved in the formation of cell-cell junctions, including adherens junctions and synapses. It has been shown to induce endocytosis-mediated down-regulation of PVR from the cell surface, resulting in reduction of cell movement and proliferation.

References
  • Satoh-Horikawa, et al. (2000). Nectin-3, a new member of immunoglobulin-like cell adhesion molecules that shows homophilic and heterophilic cell-cell adhesion activities. J Biol Chem (UNITED STATES) . 275 (14): 10291-9.
  • Reymond N, et al. (2000). Human nectin3/PRR3: a novel member of the PVR/PRR/nectin family that interacts with afadin. Gene (NETHERLANDS). 255 (2): 347-55.
  • Size / Price
    Catalog: HG10852-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"