After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human AMIGO2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
AMIGO2cDNA Clone Product Information
cDNA Size:1569
cDNA Description:ORF Clone of Homo sapiens adhesion molecule with Ig-like domain 2 DNA.
Gene Synonym:ALI1, DEGA, AMIGO2
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

AMIGO2 contains Ig-like C2-type (immunoglobulin-like) domain, 6 LRR (leucine-rich) repeats, 1 LRRCT domain and 1 LRRNT domain. It belongs to the immunoglobulin superfamily, AMIGO family. AMIGO2 may mediate homophilic as well as heterophilic cell-cell interaction with AMIGO1 or AMIGO3. It is required for depolarization-dependent survival of cultured cerebellar granule neurons. AMIGO2 may also contribute to signal transduction through its intracellular domain. It may play a role in the tumorigenesis of a subset of gastric adenocarcinomas. AMIGO2 is highly expressed in breast, ovary, cervix, and uterus.

  • Rouhiainen A, et al. (2003) AMIGO, a transmembrane protein implicated in axon tract development, defines a novel protein family with leucine-rich repeats. J Cell Biol. 160:963-73.
  • Kikkawa Y, et al. (2003) Alivin 1, a novel neuronal activity-dependent gene, inhibits apoptosis and promotes survival of cerebellar granule neurons. J Neurosci. 23:5887-96.
  • Bassi R, et al. (2004) DEGA/AMIGO-2, a leucine-rich repeat family member, differentially expressed in human gastric adenocarcinoma: effects on ploidy, chromosomal stability, cell adhesion/migration and tumorigenicity. Oncogene 23:5056-67.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks