Quick Order

Text Size:AAA

Human CYP2D6 ORF mammalian expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Human CYP2D6 cDNA Clone Product Information
NCBI RefSeq:NM_000106.4
RefSeq ORF Size:1494bp
cDNA Description:Full length Clone DNA of Homo sapiens cytochrome P450, family 2, subfamily D, polypeptide 6 with N terminal His tag.
Gene Synonym:CPD6, CYP2D, CYP2DL1, CYPIID6, P450C2D, P450DB1, CYP2D7AP, CYP2D7BP, CYP2D7P2, CYP2D8P2, P450-DB1, MGC120389, MGC120390, CYP2D6
Species:Human
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Size / Price
Catalog: HG12022-NH
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"