After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human GRK5 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
GRK5cDNA Clone Product Information
cDNA Size:1773
cDNA Description:ORF Clone of Homo sapiens G protein-coupled receptor kinase 5 DNA.
Gene Synonym:GPRK5, GRK5
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

G protein-coupled receptor kinase 5, also known as G protein-coupled receptor kinase GRK5 and GRK5, is a member of the protein kinase superfamily, AGC Ser/Thr protein kinase family and GPRK subfamily. GRKs specifically phosphorylate agonist-occupied G protein-coupled receptors at the inner surface of the plasma membrane (PM), leading to receptor desensitization. GRKs utilize a variety of mechanisms to bind tightly, and sometimes reversibly, to cellular membranes. GRKs play an important role in mediating agonist-specific desensitization of numerous G protein-coupled receptors.
GRK5 contains one AGC-kinase C-terminal domain, one protein kinase domain and one RGS domain. GRK5 specifically phosphorylates the activated forms of G protein-coupled receptors. Phospholipid-stimulated autophosphorylation may represent a novel mechanism for membrane association and regulation of GRK5 activity. GRK5 deficiency significantly exaggerates microgliosis and astrogliosis in the presence of an inflammatory initiator, such as the excess fibrillar Abeta and the subsequent active inflammatory reactions. GRK5 deficiency has been linked to early Alzheimer's disease in humans and mouse models of the disease.

  • Kunapuli,P. et al., 1994, J Biol Chem. 269 (14):10209-12.
  • Millman,E.E. et al., 2004, Br J Pharmacol  141 (2):277-84.
  • Thiyagarajan,M.M. et al., 2004, J Biol Chem  279 (17):17989-95.
  • Suo,Z. et al., 2007,Neurobiol Aging. 28 (12):1873-88.
  • Li,L. et al., 2008,J Neuroinflammation. 5 :24.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items