Quick Order

Human CD150 / SLAM Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SLAMF1cDNA Clone Product Information
cDNA Size:1008
cDNA Description:ORF Clone of Homo sapiens signaling lymphocytic activation molecule family member 1 DNA.
Gene Synonym:SLAM, CD150, CDw150, SLAMF1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Human CD150 / SLAM Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged on other vectors
Related Products
Product nameProduct name

CD150/signaling lymphocytic activation molecule (SLAM) is a cell surface sialylated phosphoglycoprotein and belongs to the CD2 subset of the Ig superfamily of type I transmembrane glycoproteins. The CD150 receptor is expressed on thymocytes, activated and memory T cells, B cells, platelets, natural killer T cells, and mature dendritic cells, and is also detected on tumor cells of Hodgkin's lymphoma (HL) and diffuse large B-cell lymphoma with an activated B cell phenotype. Additionally, it is the immune cell receptor for measles virus (MV). As a self-ligand, CD150 performs diverse immunologic functions including T/B-cell costimulation, induction of IFN-&gamma in Th1 T-cell clones, redirection of Th2 clones to a Th1 or Th0 phenotype, and inhibition of apoptosis in B cells. Furthermore, CD150 was shown to be the second receptor for measles virus in addition to CD46, and the distribution of SLAM on various cell lines is consistent with their susceptibility to clinical isolates of measles virus.

  • Tatsuo H, et al. (2002) The morbillivirus receptor SLAM (CD150). Microbiol Immunol. 46(3): 135-42.
  • Sidorenko SP, et al. (2003)The dual-function CD150 receptor subfamily: the viral attraction. Nat Immunol. 4(1): 19-24.
  • Yurchenko MY, et al. (2010) CD150 regulates JNK1/2 activation in normal and Hodgkin's lymphoma B cells. Immunol Cell Biol. 88(5): 565-74.
  • Leonard VH, et al. (2010) Measles virus selectively blind to signaling lymphocytic activation molecule (SLAM ; CD150) is attenuated and induces strong adaptive immune responses in rhesus monkeys. J Virol. 84(7): 3413-20.