Quick Order

Cynomolgus monkey SERPINA3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SERPINA3cDNA Clone Product Information
cDNA Size:1272
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3 DNA.
Gene Synonym:SERPINA3
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

Human SerpinA3, also known as Alpha 1-antichymotrypsin (AACT), is a plasma alpha globulin glycoprotein, and is a member of serpin superfamily of the serine protease inhibitors consisting of at least 35 members. SerpinA3 has been demonstrated to inhibit the activity of certain serine proteases, such as cathepsin G found in neutrophils, and chymases present in mast cells, by inducing a major conformational rearrangement, and thus protects some tissues from damage caused by proteolytic enzymes. This enzyme is produced primarily in the liver, and is identified as an acute-phase inflammatory protein. SerpinA3 deficiency has been associated with liver disease, and mutations of this gene have been observed in patients with Parkinson disease and chronic obstructive pulmonary disease. In addition, ACT gene polymorphism has been implicated with Alzheimer’s disease (AD), cerebral amyloid angiopathy (CAA), as well as stroke, since SerpinA3 is a major constituent of the plaques in AD and an inhibitor of amyloid beta peptide degradation.

  • Nilsson, L.N. et al., 2001, J. Neurosci. 21: 1444-1451.
  • Ikari, Y. et al., 2001, J. Biol. Chem. 276: 11798-11803.
  • Vila, N. et al., 2000, Stroke. 31: 2103-2105
  • Eriksson, S. et al., 1995, Proc. Natl. Acad. Sci. USA. 92: 2313-2317.
  • Skeel, A. et al., 2001, J. Biol. Chem. 276: 21932-21937.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items