Quick Order

Human RPS6KA2 / RSK3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
RPS6KA2cDNA Clone Product Information
cDNA Size:2202
cDNA Description:ORF Clone of Homo sapiens ribosomal protein S6 kinase, 90kDa, polypeptide 2 DNA.
Gene Synonym:RSK, HU-2, RSK3, p90-RSK3, pp90RSK3, MAPKAPK1C, S6K-alpha, S6K-alpha2, RPS6KA2
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Human RPS6KA2 / RSK3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged on other vectors
Human RPS6KA2 / RSK3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10833-ACG$345
Human RPS6KA2 / RSK3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10833-ACR$345
Human RPS6KA2 / RSK3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10833-ANG$345
Human RPS6KA2 / RSK3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10833-ANR$345
Human RPS6KA2 / RSK3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10833-CF$315
Human RPS6KA2 / RSK3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10833-CH$315
Human RPS6KA2 / RSK3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10833-CM$315
Human RPS6KA2 / RSK3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10833-CY$315
Human RPS6KA2 / RSK3 Gene cDNA Clone (full-length ORF Clone)HG10833-M$115
Human RPS6KA2 / RSK3 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10833-M-N$345
Human RPS6KA2 / RSK3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10833-NF$315
Human RPS6KA2 / RSK3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10833-NH$315
Human RPS6KA2 / RSK3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10833-NM$315
Human RPS6KA2 / RSK3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10833-NY$315
Human RPS6KA2 / RSK3 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10833-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name

Ribosomal protein S6 kinase alpha-2, also known as 90 kDa ribosomal protein S6 kinase 2, MAP kinase-activated protein kinase 1c, MAPK-activated protein kinase 1c, Ribosomal S6 kinase 3, RSK-3, RPS6KA2 and MAPKAPK1C, is a nucleus protein which belongs to the protein kinase superfamily, AGC Ser/Thr protein kinase family and S6 kinase subfamily. RPS6KA2 / RSK-3 is expressed in many tissues. Highest expression is in lung and skeletal muscle. The expression of RPS6KA2 reduced proliferation, caused G1 arrest, increased apoptosis, reduced levels of phosphorylated extracellular signal-regulated kinase and altered other cell cycle proteins. RPS6KA2 / RSK-3 contains one AGC-kinase C-terminal domain and two protein kinase domains. It forms a complex with either ERK1 or ERK2 in quiescent cells. It transiently dissociates following mitogenic stimulation. RPS6KA2 / RSK-3 is a serine/threonine kinase that may play a role in mediating the growth-factor and stress induced activation of the transcription factor CREB. RPS6KA1, RPS6KA2, RPS6KB1, RPS6KB2, and PDK1 are involved in several pathways central to the carcinogenic process, including regulation of cell growth, insulin, and inflammation. 

Size / Price
List Price: $315.00  (Save $0.00)
Price:$315.00      [How to order]
Availability2-3 weeks