Quick Order

Text Size:AAA

Human LGALS7 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
LGALS7cDNA Clone Product Information
cDNA Size:411
cDNA Description:ORF Clone of Homo sapiens lectin, galactoside-binding, soluble, 7 DNA.
Gene Synonym:GAL7, LGALS7A, LGALS7
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

LGALS7, also known as Galectin-7, is a member of the galectins family. The galectins are a family of beta-galactoside-binding proteins. There are at least 14 identified members in this family. Galectins share similarities in the CRD (the carbohydrate recognition domain). They are synthesized as cytosolic proteins. Though localized principally in the cytoplasm and lacking a classical signal peptide, galectins can also be stimulated to secretion by non-classical pathways or alternatively targeted to the nucleus. Galectins are implicated in modulating cell-cell and cell-matrix interactions. LGALS7 contains 1 galectin domain and is mainly expressed in stratified squamous epithelium. Galectin-7 could be involved in cell-cell and/or cell-matrix interactions necessary for normal growth control. LGALS7 is a pro-apoptotic protein that functions intracellularly upstream of JNK activation and cytochrome c release.

  • Villeneuve C, et al. (2011) Mitochondrial proteomic approach reveals galectin-7 as a novel BCL-2 binding protein in human cells. Mol Biol Cell. 22(7):999-1013.
  • Rondanino C, et al. (2011) Galectin-7 modulates the length of the primary cilia and wound repair in polarized kidney epithelial cells. Am J Physiol Renal Physiol. 301(3):F622-33.
  • Masuyer G, et al. (2012) Inhibition mechanism of human galectin-7 by a novel galactose-benzylphosphate inhibitor. FEBS J. 279(2):193-202.
  • Magnaldo T, et al. (1995) Galectin-7, a human 14-kDa S-lectin, specifically expressed in keratinocytes and sensitive to retinoic acid. Dev Biol. 168(2):259-71.
  • Madsen P, et al. (1995) Cloning, expression, and chromosome mapping of human galectin-7. J Biol Chem. 270(11):5823-29.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items