After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Human WFIKKN2 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human WFIKKN2 cDNA Clone Product Information
Gene_bank_ref_id:NM_175575.5
RefSeq ORF Size:1731bp
cDNA Description:Full length Clone DNA of Homo sapiens WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 2 with N terminal His tag.
Gene Synonym:GASP-1, hGASP-1, WFIKKNRP, WFIKKN2
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

WAP, kazal, immunoglobulin, kunitz and NTR domain-containing protein 2, also known as Growth and differentiation factor-associated serum protein 1, WAP, follistatin, immunoglobulin, kunitz and NTR domain-containing-related protein, WFIKKN-related protein, WFIKKN2 and GASP1, is a secreted protein which belongs to the WFIKKN family. WFIKKN2 contains two BPTI/Kunitz inhibitor domains, one Ig-like C2-type (immunoglobulin-like) domain, one Kazal-like domain, one NTR domain and one WAP domain. WFIKKN2 is primarily expressed in ovary, testis and brain, but not in liver. In fetal tissues, it is primarily expressed in brain, skeletal muscle, thymus and kidney. WFIKKN2 is protease-inhibitor that contains multiple distinct protease inhibitor domains. It probably has serine protease- and metalloprotease-inhibitor activity. It inhibits the biological activity of mature myostatin, but not activin. WFIKKN2 protein binds mature GDF8/myostatin and myostatin propeptide and inhibits the biological activity of myostatin.

References
  • Clark H.F.et al., 2003,Genome Res. 13:2265-70.
  • Hill J.J.et al., 2003, Mol. Endocrinol. 17:1144-54.
  • Kondás,K. et al., 2008, J Biol Chem  283 (35):23677-84.
  • Size / Price
    Catalog: HG11998-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"