Quick Order

Text Size:AAA

Human KEAP1 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human KEAP1 cDNA Clone Product Information
Gene_bank_ref_id:NM_012289.3
RefSeq ORF Size:1865bp
cDNA Description:Full length Clone DNA of Homo sapiens kelch-like ECH-associated protein 1 with N terminal His tag.
Gene Synonym:INrf2, KLHL19, MGC1114, MGC4407, MGC9454, KIAA0132, MGC10630, MGC20887, KEAP1
Species:Human
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Kelch-like ECH-associated protein 1, also known as cytosolic inhibitor of Nrf2, Kelch-like protein 19, KEAP1 and INRF2, is a cytoplasm and nucleus protein which contains one BACK (BTB/Kelch associated) domain, one BTB (POZ) domain and six Kelch repeats. KEAP1 / INRF2 is broadly expressed, with highest levels in skeletal muscle. KEAP1 / INRF2 is a key regulator of the NRF2 transcription factor, which transactivates the antioxidant response element (ARE) and upregulates numerous proteins involved in antioxidant defense. Under basal conditions, KEAP1 / INRF2 targets NRF2 for ubiquitination and proteolytic degradation and as such is responsible for the rapid turnover of NRF2. KEAP1 / INRF2 retains NFE2L2 / NRF2 in the cytosol. KEAP1 / INRF2 functions as substrate adapter protein for the E3 ubiquitin ligase complex formed by CUL3 and RBX1. It targets NFE2L2 / NRF2 for ubiquitination and degradation by the proteasome, thus resulting in the suppression of its transcriptional activity and the repression of antioxidant response element-mediated detoxifying enzyme gene expression. KEAP1 / INRF2 may also retain BPTF in the cytosol. It targets PGAM5 for ubiquitination and degradation by the proteasome.

References
  • Strachan GD. et al., 2004, Biochemistry. 43: 12113-22.
  • Zhang DD. et al., 2004, Mol Cell Biol. 24: 10941-53.
  • Zhang DD. et al., 2003, Mol Cell Biol. 23: 8137-51.
  • Lo S-C. et al., 2006, J Biol Chem. 281: 37893-903.
  • Buckley BJ. et al., 2008, Free Radic Biol Med. 44 (4) :692-8.
  • Size / Price
    Catalog: HG11981-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"