Quick Order

Human SARS coronavirus (SARS-CoV) Spike glycoprotein ORF mammalian expression plasmid (Codon Optimized)

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SARS Spike cDNA Clone Product Information
RefSeq ORF Size:3768bp
cDNA Description:Full length Clone DNA of Human SARS coronavirus (SARS-CoV) Spike glycoprotein DNA.
Gene Synonym:Spike
Restriction Site:HindIII + XhoI (5.5kb + 3.77kb)
Tag Sequence:
Sequence Description:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with AAP13567.1.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
SARS Spike Gene Plasmid Map
Human SARS coronavirus (SARS-CoV) Spike glycoprotein Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Human SARS coronavirus (SARS-CoV) Spike glycoprotein ORF mammalian expression plasmid (Codon Optimized) on other vectors
Product nameProduct name

The spike (S) glycoprotein of coronaviruses contains protrusions that will only bind to certain receptors on the host cell: they are essential for both host specificity and viral infectivity. The term 'peplomer' is typically used to refer to a grouping of heterologous proteins on the virus surface that function together. The spike (S) glycoprotein of coronaviruses is known to be essential in the binding of the virus to the host cell at the advent of the infection process. Most notable is severe acute respiratory syndrome (SARS). The severe acute respiratory syndrome-coronavirus (SARS-CoV) spike (S) glycoprotein alone can mediate the membrane fusion required for virus entry and cell fusion. It is also a major immunogen and a target for entry inhibitors. The SARS-CoV spike (S) protein is composed of two subunits; the S1 subunit contains a receptor-binding domain that engages with the host cell receptor angiotensin-converting enzyme 2 and the S2 subunit mediates fusion between the viral and host cell membranes. The S protein plays key parts in the induction of neutralizing-antibody and T-cell responses, as well as protective immunity, during infection with SARS-CoV. 

  • Shen S, et al. (2007) Expression, glycosylation, and modification of the spike (S) glycoprotein of SARS CoV. Methods Mol Biol. 379: 127-35.
  • Du L, et al. (2009) The spike protein of SARS-CoV--a target for vaccine and therapeutic development. Nat Rev Microbiol. 7 (3): 226-36.
  • Xiao X, et al. (2004) The SARS-CoV S glycoprotein. Cell Mol Life Sci. 61 (19-20): 2428-30.
  • Size / Price
    Catalog: VG40150-G-N
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions