Quick Order

Text Size:AAA

Human FANCA transcript variant 1 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human FANCA cDNA Clone Product Information
Gene_bank_ref_id:NM_000135.2
RefSeq ORF Size:4368bp
cDNA Description:Full length Clone DNA of Homo sapiens Fanconi anemia, complementation group A, transcript variant 1 with N terminal His tag.
Gene Synonym:FA, FA1, FAA, FAH, FA-H, FACA, FANCH, MGC75158, FANCA
Species:Human
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Human FANCA transcript variant 1 ORF mammalian expression plasmid, N-His tag on other vectors
Product nameProduct name
Background

FANCA is one of the six known Fanconi anemia gene products (FANCA, FANCC, FANCD2, FANCE, FANCF, and FANCG proteins). Fanconi anemia (FA) is a genetic disorder predisposing to aplastic anemia and cancer characterized by hypersensitivity to DNA-damaging agents and oxidative stress. FANCA associates with the IκB kinase (IKK) signalsome via interaction with IKK2. Components of the FANCA complex undergo rapid, stimulus-dependent changes in phosphorylation, which are blocked by kinase-inactive IKK2.

References
  • Otsuki T, et al. (2002) Fanconi anemia protein complex is a novel target of the IKK signalsome. J Cell Biochem. 86 (4): 613-23.
  • Taniguchi T, et al. (2002) The Fanconi anemia protein, FANCE, promotes the nuclear accumulation of FANCC. Blood. 100 (7): 2457-62.
  • Garcia-Higuera I, et al. (1999) Fanconi anemia proteins FANCA, FANCC, and FANCG / XRCC9 interact in a functional nuclear complex. Mol Cell Biol. 19 (7): 4866-73.
  • Size / Price
    Catalog: HG11980-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"