After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human Uteroglobin / SCGB1A1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SCGB1A1cDNA Clone Product Information
cDNA Size:276
cDNA Description:ORF Clone of Homo sapiens secretoglobin, family 1A, member 1 (uteroglobin) DNA.
Gene Synonym:UGB, CC10, CC16, CCSP, SCGB1A1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Human Uteroglobin / SCGB1A1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged on other vectors
Related Products
Product nameProduct name

Uteroglobin (UG), also known as Secretoglobin 1A member 1 (SCGB1A1), Blastokinin, Clara cell secretor protein (CCSP) or Clara cell-specific 10-kDa protein (CC10), is the founding member of the secretoglobin family of small, secreted, disulfide-bridged dimeric proteins found only in mammals. This protein is mainly expressed in lung, with anti-inflammatory/immunomodulatory properties. Previous in vitro studies demonstrated that CCAAT/enhancer-binding proteins (C/EBPs) are the major transcription factors for the regulation of SCGB1A1 gene expression, whereas FOXA1 had a minimum effect on the transcription. Uteroglobin is a multifunctional protein with antiinflammatory/immunomodulatory properties. Uteroglobin inhibits soluble phospholipase A(2) activity and binds and perhaps sequesters hydrophobic ligands such as progesterone, retinols, polychlorinated biphenyls, phospholipids, and prostaglandins. In addition to its antiinflammatory activities, Uteroglobin manifests antichemotactic, antiallergic, antitumorigenic, and embryonic growth-stimulatory activities. The tissue-specific expression of the Uteroglobin gene is regulated by several steroid hormones, although a nonsteroid hormone, prolactin, further augments its expression in the uterus. Based on its anti-inflammatory and antiallergic properties, Uteroglobin is a potential drug target. The mechanism of Uteroglobin action is likely to be even more complex as it also functions via a putative receptor-mediated pathway.

  • Mukherjee AB, et al. (1999). Uteroglobin: a novel cytokine? Cell Mol Life Sci. 55(5): 771-87.
  • Klug J, et al. (2000). Uteroglobin/Clara cell 10-kDa family of proteins: nomenclature committee report. Ann. N. Y. Acad. Sci. 923: 348-54.
  • Laukaitis CM, et al. (2005). Evolution of the secretoglobins: a genomic and proteomic view. Biological Journal of the Linnean Society. 84 (3): 493-501.
  • Mukherjee AB, et al. (2007). Uteroglobin: a steroid-inducible immunomodulatory protein that founded the Secretoglobin superfamily. Endocr Rev. 28(7): 707-25.
  • Kido T, et al. (2011). FOXA1 plays a role in regulating secretoglobin 1a1 expression in the absence of CCAAT/enhancer binding protein activities in lung in vivo. Am J Physiol Lung Cell Mol Physiol. 300(3): L441-52.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items