Quick Order

Text Size:AAA

Human LILRB3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
LILRB3cDNA Clone Product Information
Gene_bank_ref_id:
cDNA Size:1896
cDNA Description:ORF Clone of Homo sapiens leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 3 DNA.
Gene Synonym:HL9, ILT5, LIR3, PIRB, CD85A, LIR-3, MGC138403, LILRB3
Species:Human
Vector:pCMV3-N-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name
Background

Leukocyte immunoglobulin-like receptor subfamily B member 3, also known as Leukocyte immunoglobulin-like receptor 3, Immunoglobulin-like transcript 5, Monocyte inhibitory receptor HL9, CD85 antigen-like family member A, CD85a and LILRB3, is a single-pass type I  membrane protein which belongs to the leukocyte receptor cluster (LRC) present on 19q13.4. LILRB3 / CD85a contains four Ig-like C2-type (immunoglobulin-like) domains. LILRB3 / CD85a contains three copies of a cytoplasmic motif that is referred to as the immunoreceptor tyrosine-based inhibitor motif (ITIM). This motif is involved in modulation of cellular responses. The phosphorylated ITIM motif can bind the SH2 domain of several SH2-containing phosphatases. LILRB3 / CD85a is expressed on immune cells where it binds to MHC class I molecules on antigen-presenting cells and transduces a negative signal that inhibits stimulation of an immune response. It is thought to control inflammatory responses and cytotoxicity to help focus the immune response and limit autoreactivity. Multiple transcript variants encoding different isoforms have been found.

References
  • Huang,J. et al., 2010, J Virol. 84 (18): 9463-71.
  • Arm J.P. et al., 1997, J. Immunol. 159:2342-2349.
  • Wende H. et al., 2000, Immunogenetics 51:703-713.
  • Yu L.-R. et al., 2007,J. Proteome Res. 6:4150-4162.
  • Size / Price
    Catalog:HG11978-NH
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"