Quick Order

Human HIF1A ORF mammalian expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Human HIF1A cDNA Clone Product Information
NCBI RefSeq:NM_001530
RefSeq ORF Size:2481bp
cDNA Description:Full length Clone DNA of Homo sapiens hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor) with N terminal His tag.
Gene Synonym:MOP1, HIF-1alpha, PASD8, HIF1, bHLHe78
Species:Human
Vector:pCMV3-N-His
Plasmid:pCMV3-His-HIF1A
Restriction Site:KpnI + XbaI (6kb + 2.53kb)
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human HIF1A Gene Plasmid Map
Human HIF1A natural ORF mammalian expression plasmid, N-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

HIF-1 alpha, also known as HIF1A, contains 1 basic helix-loop-helix (bHLH) domain, 1 PAC (PAS-associated C-terminal) domain and 2 PAS (PER-ARNT-SIM) domains. It is one of the two subunits of Hypoxia-inducible factor-1 (HIF1). HIF1 is a transcription factor found in mammalian cells cultured under reduced oxygen tension that plays an essential role in cellular and systemic homeostatic responses to hypoxia. HIF1 is a heterodimer composed of an alpha subunit and a beta subunit. The beta subunit has been identified as the aryl hydrocarbon receptor nuclear translocator (ARNT). HIF-1 alpha is expressed in most tissues with highest levels in kidney and heart. It is overexpressed in the majority of common human cancers and their metastases, due to the presence of intratumoral hypoxia and as a result of mutations in genes encoding oncoproteins and tumor suppressors. HIF-1 alpha functions as a master transcriptional regulator of the adaptive response to hypoxia. Under hypoxic conditions, it activates the transcription of over 40 genes, including erythropoietin, glucose transporters, glycolytic enzymes, vascular endothelial growth factor, HILPDA, and other genes whose protein products increase oxygen delivery or facilitate metabolic adaptation to hypoxia. HIF1A plays an essential role in embryonic vascularization, tumor angiogenesis and pathophysiology of ischemic disease. HIF-1 alpha binds to core DNA sequence 5'-[AG]CGTG-3' within the hypoxia response element (HRE) of target gene promoters. Activation requires recruitment of transcriptional coactivators such as CREBPB and EP300.

References
  • Zhou Q, et al. (2011) Loss of either hypoxia inducible factor 1 or 2 promotes lung cancer cell colonization. Cell Cycle. 10(13):2233-4.
  • Krishnan J, et al. (2012) Dietary obesity-associated Hif1 alpha activation in adipocytes restricts fatty acid oxidation and energy expenditure via suppression of the Sirt2-NAD+ system. Genes Dev. 26(3):259-70.
  • Novo E, et al. (2012) The biphasic nature of hypoxia-induced directional migration of activated human hepatic stellate cells. J Pathol. 226(4):588-97.
  • Dungwa JV, et al. (2011) Overexpression of carbonic anhydrase and HIF-1 in Wilms tumours. BMC Cancer. 11:390.
  • Size / Price
    Catalog: HG11977-NH
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn StockShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"