Quick Order

Text Size:AAA

Human STATH Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
STATHcDNA Clone Product Information
cDNA Size:189
cDNA Description:ORF Clone of Homo sapiens statherin DNA.
Gene Synonym:STR, STATH
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

Statherin, also known as STATH, belongs to the histatin/statherin family. Statherin may play an important role in the maintenance of oral health.It prevents calcium phospate precipitation in saliva, so maintaining a high calcium level in saliva and preventing teeth from dissolving. Statherin also inhibits spontaneous precipitation of calcium phosphate salts. Thus, statherin and PRPs may prevent build-up of harmful deposits in the salivary glands and on the tooth surfaces.Statherin is a highly stable salivary protein of low molecular mass (5,380). Sabatini et al. synthesized mixed oligonucleotides based on the known amino acid sequence of statherin and used these to screen a cDNA library constructed from human parotid gland mRNA.

  • Sabatini LM. et al., 1998, Am J Hum Genet. 41 (6): 1048-60.
  • Schlesinger DH. et al., 1997, J Biol Chem. 252 (5): 1689-95.
  • Raj PA. et al., 1992, J Biol Chem. 267 (9): 5968-76.
  • Douglas WH. et al., 1991, Biochem Biophys Res Commun. 180 (1): 91-7.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks