Quick Order

Human MAP3K8 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
MAP3K8cDNA Clone Product Information
cDNA Size:1404
cDNA Description:ORF Clone of Homo sapiens mitogen-activated protein kinase kinase kinase 8 DNA.
Gene Synonym:COT, EST, ESTF, TPL2, Tpl-2, c-COT, FLJ10486
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Human MAP3K8 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged on other vectors
Human MAP3K8 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10800-ACG$325
Human MAP3K8 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10800-ACR$325
Human MAP3K8 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10800-ANG$325
Human MAP3K8 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10800-ANR$325
Human MAP3K8 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10800-CF$295
Human MAP3K8 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10800-CH$295
Human MAP3K8 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10800-CM$295
Human MAP3K8 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10800-CY$295
Human MAP3K8 Gene cDNA Clone (full-length ORF Clone)HG10800-M$95
Human MAP3K8 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG10800-M-F$295
Human MAP3K8 Gene cDNA Clone (full-length ORF Clone), expression ready, His-taggedHG10800-M-H$295
Human MAP3K8 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10800-M-N$295
Human MAP3K8 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10800-NF$295
Human MAP3K8 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10800-NH$295
Human MAP3K8 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10800-NM$295
Human MAP3K8 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10800-NY$295
Human MAP3K8 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10800-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

Mitogen-activated protein kinase kinase kinase 8, also known as Cancer Osaka thyroid oncogene, Proto-oncogene c-Cot, Serine/threonine-protein kinase cot, Tumor progression locus 2 and MAP3K8, is a cytoplasm protein which belongs to the protein kinase superfamily, STE Ser/Thr protein kinase family and MAP kinase kinase kinase subfamily. MAP3K8 is expressed in several normal tissues and human tumor-derived cell lines. Isoform 1 of MAP3K8 is activated specifically during the S and G2/M phases of the cell cycle. MAP3K8 is required for TLR4 activation of the MEK/ERK pathway. It is able to activate NF-kappa-B 1 by stimulating proteasome-mediated proteolysis of NF-kappa-B 1/p105. MAP3K8 plays a role in the cell cycle. The longer form has some transforming activity, although it is much weaker than the activated cot oncoprotein. MAP3K8 oncogene linked to human endometrial carcinoma suggesting that it may be another molecule involved in human endometrial cancer. MAP3K8 may also be an important mediator of intracellular mechanotransduction in human bone marrow-derived mesenchymal stem cells (MSCs).

  • Clark,A.M. et al., 2004, Genes Chromosomes Cancer. 41 (2):99-108.
  • Chan,H. et al., 2005, Biochem Biophys Res Commun. 328 (1):198-205.
  • Aparecida Alves,C. et al., 2006, Eur J Gynaecol Oncol. 27 (6):589-93.
  • Mielke,L.A. et al., 2009, J Immunol. 183 (12):7984-93.
  • Glossop,J.R. et al., 2009,Gene Expr Patterns  9 (5):381-8. 
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items