After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human VNN2 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human VNN2 cDNA Clone Product Information
Gene_bank_ref_id:NM_004665.2
RefSeq ORF Size:1563bp
cDNA Description:Full length Clone DNA of Homo sapiens vanin 2 with N terminal His tag.
Gene Synonym:FOAP-4, GPI-80
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Vascular non-inflammatory molecule 2, also known as glycosyl-phosphatidyl inositol-anchored protein GPI-80, Vanin-2, Protein FOAP-4 and VNN2, is a cell membrane protein which belongs to the CN hydrolase family and Vanin subfamily. VNN2 is widely expressed with higher expression in spleen and blood. VNN2 is a member of the vanin family of proteins which share extensive sequence similarity with each other, and also with biotinidase. The family includes secreted and membrane-associated proteins, a few of which have been reported to participate in hematopoietic cell trafficking. No biotinidase activity has been demonstrated for any of the vanin proteins, however, they possess pantetheinase activity, which may play a role in oxidative-stress response. VNN2 is an amidohydrolase that hydrolyzes specifically one of the carboamide linkages in D-pantetheine thus recycling pantothenic acid (vitamin B5) and releasing cysteamine. It is involved in the thymus homing of bone marrow cells. VNN2 plays a role in transendothelial migration of neutrophils and may regulate beta-2 integrin-mediated cell adhesion, migration and motility of neutrophil.

References
  • Suzuki K. et al., 1999, J. Immunol. 162: 4277-84.
  • Martin, F. et al., 2001,Immunogenetics. 53 (4):296-306.
  • Liu T.et al., 2005, J. Proteome Res. 4: 2070-80.
  • Jansen P.AM. et al., 2009, J. Invest. Dermatol. 129: 2167-74.
  • Size / Price
    Catalog: HG11728-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"