After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human respiratory syncytial virus (RSV) (subtype B, strain B1) glycoprotein G / RSV-G Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
RSV-GcDNA Clone Product Information
cDNA Size:900
cDNA Description:ORF Clone of Human RSV (subtype B, strain B1) Major surface glycoprotein G DNA.
Gene Synonym:RSV-G
Restriction Site:HindIII + XhoI
Tag Sequence:
Sequence Description:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with NP_056862.1.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Related Products
Product nameProduct name

Human respiratory syncytial virus (HRSV) is the most common etiological agent of acute lower respiratory tract disease in infants and can cause repeated infections throughout life. It is classified within the genus pneumovirus of the family paramyxoviridae. Like other members of the family, HRSV has two major surface glycoproteins (G and F) that play important roles in the initial stages of the infectious cycle. HRSV G protein is a type II glycoprotein of 289-299 amino acids (depending on the virus strain) with a signal/anchor hydrophobic domain and is extensively modified by the addition of both N-and O-linked oligosaccharides to achieve the mature form of 80-90 kDa. The C-terminal ectodomain of the G protein has a central region and four cysteines which are conserved in all HRSV isolates and have been proposed as the putative receptor binding site. The G protein mediates attachment of the virus to the host cell membrane by interacting with heparan sulfate, initiating the infection. As similar to mucins in amino acid compositions, the RSV G protein can interact with host CX3CR1, the receptor for the CX3C chemokine fractalkine, and thus modulates the immune response and facilitate infection. Secreted glycoprotein G helps RSV escape antibody-dependent restriction of replication by acting as an antigen decoy and by modulating the activity of leukocytes bearing Fcgamma receptors. Unlike the other paramyxovirus attachment proteins, HRSV-G lacks both neuraminidase and hemagglutinating activities.

  • Martin-Gallardo A. et al., 1993, J Gen Virol. 74 : 453-8.
  • Jose AM. et al.,1997, J Gen Virol. 78: 2411-8.
  • Feldman SA. et al., 1999, J Virol. 73: 6610-7.
  • García-Beato R. et al., 2000, J Gen Virol. 81: 919-27.
  • Zlateva KT. et al., 2004, J Virol. 78: 4675-83.
  • Trento A. et al., 2006, J Virol. 80: 975-84.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 business days
    • Human respiratory syncytial virus (RSV) (subtype B, strain B1) glycoprotein G / RSV-G Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, untagged
    Recently Viewed Items