Quick Order

Ebola virus EBOV (subtype Sudan, strain Gulu) Glycoprotein / GP ORF mammalian expression plasmid (Codon Optimized)

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
EBOV EBOV-G cDNA Clone Product Information
RefSeq ORF Size:2031bp
cDNA Description:Full length Clone DNA of Ebola virus (EBOV) (subtype Sudan, strain Gulu) Glycoprotein / GP DNA.
Gene Synonym:EBOV-G
Plasmid:pCMV-GP(Sudan ebolavirus)
Restriction Site:HindIII + XhoI (5.5kb + 2.03kb)
Tag Sequence:
Sequence Description:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with YP_138523.1.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

The fourth gene of the EBOV genome encodes a 160-kDa envelope-attached glycoprotein (GP) and a 110 kDa secreted glycoprotein (sGP). Both GP and sGP have an identical 295-residue N-terminus, however, they have different C-terminal sequences. Recently, great attention has been paid to GP for vaccines design and entry inhibitors isolation. GP is a class I fusion protein which assembles as trimers on viral surface and plays an important role in virus entry and attachment. Mature GP is a disulfide-linked heterodimer formed by two subunits, GP1 and GP2, which are generated from the proteolytical process of GP precursor (pre-GP) by cellular furin during virus assembly . The GP1 subunit contains a mucin domain and a receptor-binding domain (RBD); the GP2 subunit has a fusion peptide, a helical heptad-repeat (HR) region, a transmembrane (TM) domain, and a 4-residue cytoplasmic tail. The RBD of GP1 mediates the interaction of EBOV with cellular receptor (e.g. DC-SIGN/LSIGN, TIM-1, hMGL, NPC1, β-integrins, folate receptor-α, and Tyro3 family receptors), of which TIM1 and NPC1 are essential for EBOV entry; the mucin domain having N- and O-linked glycans enhances the viral attachment to cellular hMGL, and participates in shielding key neutralization epitopes, which helps the virus evades immune elimination. There are large conformation changes of GP2 during membrane fusion, which enhance the insertion of fusion loop into cellular membrane and facilitate the release of viral nucleocapsid core to cytoplasm.

  1. Volchkov VE, et al. Processing of the Ebola virus glycoprotein by the proprotein convertase furin. Proc Natl Acad Sci U S A. 1998 May 12;95(10):5762-7.
  2. Lee JE, et al. Structure of the Ebola virus glycoprotein bound to an antibody from a human survivor. Nature. 2008 Jul 10;454(7201):177-82. doi: 10.1038/nature07082.
  3. Hood CL, et al. Biochemical and structural characterization of cathepsin L-processed Ebola virus glycoprotein: implications for viral entry and immunogenicity. J Virol. 2010 Mar;84(6):2972-82. doi: 10.1128/JVI.02151-09.
  4. Cook JD and Lee JE. The secret life of viral entry glycoproteins: moonlighting in immune evasion. PLoS Pathog. 2013 May;9(5):e1003258. doi: 10.1371/journal.ppat.1003258.
  5. Miller EH and Chandran K. Filovirus entry into cells - new insights. Curr Opin Virol. 2012 Apr;2(2):206-14. doi: 10.1016/j.coviro.2012.02.015.