After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human USP7 / HAUSP ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human USP7 cDNA Clone Product Information
Gene_bank_ref_id:NM_003470.2
RefSeq ORF Size:3309bp
cDNA Description:Full length Clone DNA of Homo sapiens ubiquitin specific peptidase 7 (herpes virus-associated) with N terminal His tag.
Gene Synonym:TEF1, HAUSP, USP7
Species:Human
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Ubiquitin carboxyl-terminal hydrolase 7, also known as Ubiquitin thioesterase 7, Herpesvirus-associated ubiquitin-specific protease, Ubiquitin-specific-processing protease 7, USP7 and HAUSP, is a widely expressed protein which belongs to the peptidase C19 family. USP7 is a member of the family of deubiquitinating enzymes. It is involved in the regulation of stress response pathways, epigenetic silencing and the progress of infections by DNA viruses. USP7 is a protein with a cysteine peptidase core, N- and C-terminal domains required for protein-protein interactions. USP7 contributes to epigenetic silencing of homeotic genes by Polycomb (Pc). USP7 cleaves ubiquitin fusion protein substrates. It deubiquitinates TP53/p53 and MDM2 and strongly stabilizes TP53 even in the presence of excess MDM2. USP7 also induces TP53-dependent cell growth repression and apoptosis. USP7 has key roles in the p53 pathway whereby it stabilizes both p53 and MDM2. Herpes simplex virus type 1 (HSV-1) regulatory protein ICP0 stimulates lytic infection and the reactivation of quiescent viral genomes. ICP0 interacts very strongly with USP7. USP7-mediated stabilization of ICP0 is dominant over ICP0-induced degradation of USP7 during productive HSV-1 infection. The biological significance of the ICP0-USP7 interaction may be most pronounced in natural infection situations, in which limited amounts of ICP0 are expressed.

Size / Price
Catalog: HG11681-NH
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"