Quick Order

Human PRKD2 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PRKD2 cDNA Clone Product Information
NCBI RefSeq:NM_016457.4
RefSeq ORF Size:2634bp
cDNA Description:Full length Clone DNA of Homo sapiens protein kinase D2PRKD2 protein kinase D2 with N terminal His tag.
Gene Synonym:PKD2, HSPC187
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Serine/threonine-protein kinase D2, also known as PRKD2 and PKD2, is a cytoplasm and membrane protein which belongs to the protein kinase superfamily, CAMK Ser/Thr protein kinase family and PKD subfamily. PRKD2 / PKD2 is widely expressed. It contains one PH domain, two phorbol-ester/DAG-type zinc fingers and one protein kinase domain. PRKD2 / PKD2 is activated by DAG and phorbol esters. Phorbol-ester/DAG-type domains bind DAG, mediating translocation to membranes. Autophosphorylation of Ser-710 and phosphorylation of Ser-706 by PKC relieves auto-inhibition by the PH domain. PRKD2 / PKD2 converts transient diacylglycerol (DAG) signals into prolonged physiological effects, downstream of PKC. Involved in resistance to oxidative stress.

References
  • Zhang QH, et al., 2000, Genome Res 10 (10): 1546-60.
  • Di Bernardo MC, et al.,2008, Nature genetics. 40 (10) :1204-10.
  • Zhang L, et al., 2009, American journal of nephrology. 30 (6) :505-13.
  • Size / Price
    Catalog: HG11671-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"