After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human UCHL1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
UCHL1cDNA Clone Product Information
cDNA Size:672
cDNA Description:ORF Clone of Homo sapiens ubiquitin carboxyl-terminal esterase L1 (ubiquitin thiolesterase) DNA.
Gene Synonym:PARK5, PGP95, PGP9.5, Uch-L1, UCHL1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-His Vector Information
Vector Name pCMV3-N-His
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-His Physical Map

Schematic of pCMV3-N-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Human UCHL1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged on other vectors
Related Products
Product nameProduct name

Ubiquitin carboxyl-terminal hydrolase isozyme L1, also known as UCH-L1, Ubiquitin thioesterase L1, PGP9.5 and UCHL1, is a deubiqutinating enzyme with important functions in recycling of ubiquitin. Regulated proteolysis by the ubiquitin pathway has been implicated in control of the cell cycle, transcriptional activation, cell fate and growth, and synaptogenesis. The ubiquitin-proteasome system is involved in synaptic plasticity and is proposed to be part of a molecular switch that converts short-term synaptic potentiation to long-term changes in synaptic strength. UCHL1 is found in neuronal cell bodies and processes throughout the neocortex (at protein level). It is expressed in neurons and cells of the diffuse neuroendocrine system and their tumors. UCHL1 is weakly expressed in ovary. UCHL1 is a ubiquitin-protein hydrolase. It is involved both in the processing of ubiquitin precursors and of ubiquitinated proteins. This enzyme is a thiol protease that recognizes and hydrolyzes a peptide bond at the C-terminal glycine of ubiquitin. UCHL1 also binds to free monoubiquitin and may prevent its degradation in lysosomes. The homodimer of UCHL1 may have ATP-independent ubiquitin ligase activity. UCHL1 dysfunction has been associated with neurodegeneration in Parkinson's, Alzheimer's, and Huntington's disease patients. Reduced UCHL1 function may jeopardize the survival of CNS neurons.

  • Wada H., et al., 1998, Biochem. Biophys. Res. Commun. 251:688-92.
  • Choi J., et al., 2004, J. Biol. Chem. 279:13256-64.
  • Lombardino,A.2005, et al., J.Proc Natl Acad Sci.USA102 (22):8036-41
  • Okochi-Takada,E. et al., 2006, Int J Cancer. 119 (6):1338-44.
  • Zetterberg, M. et al., 2010, Mol Neurodegener  5 :11.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks