Quick Order

Cynomolgus monkey OPALIN Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
OPALINcDNA Clone Product Information
cDNA Size:426
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) oligodendrocytic myelin paranodal and inner loop protein DNA.
Gene Synonym:OPALIN
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

Opalin, or oligodendrocytic myelin paranodal and inner loop protein, is a transmembrane protein detected specifically in mammalian oligodendrocytes, and may play significant role in oligodendrocyte differentiation and myelination.Opalin has binding sites for Myt1 and cAMP-response element binding protein (CREB). Over-expression of Myt1, treatment of the cell with leukemia inhibitory factor (LIF), and cAMP analog (CREB activator) enhanced the expression of endogenous Opalin in Oli-neu cells and activated the oligodendrocyte enhancer. Thus LIF, cAMP signaling cascades and Myt1 may play significant roles in the differentiation of oligodendrocytes through their action on the Opalin oligodendrocyte enhancer. Enzymatic deglycosylation showed that myelin Opalin contained N- and O-glycans, and that the O-glycans, at least, had negatively charged sialic acids. Site-directed mutations at the glycan sites impaired the cell surface localization of Opalin. In addition to the somata and processes of oligodendrocytes, Opalin immunoreactivity was observed in myelinated axons in a spiral fashion, and was concentrated in the paranodal loop region. Immunogold electron microscopy demonstrated that Opalin was localized at particular sites in the paranodal loop membrane. These results suggest a role for highly sialylglycosylated Opalin in an intermembranous function of the myelin paranodal loops in the central nervous system.

  • Aruga J, et al. (2007) An oligodendrocyte enhancer in a phylogenetically conserved intron region of the mammalian myelin gene Opalin. J Neurochem. 102(5):1533-47.
  • Kippert A, et al. (2008) Identification of Tmem10/Opalin as a novel marker for oligodendrocytes using gene expression profiling. BMC Neurosci. 9:40.
  • Yoshikawa F, et al. (2008) Opalin, a transmembrane sialylglycoprotein located in the central nervous system myelin paranodal loop membrane. J Biol Chem. 83(30):20830-40.
  • Golan N, et al. (2008) Identification of Tmem10/Opalin as an oligodendrocyte enriched gene using expression profiling combined with genetic cell ablation. Glia. 56(11):1176-86.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks