Quick Order

Text Size:AAA

Human HSPA1A ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human HSPA1A cDNA Clone Product Information
Gene_bank_ref_id:NM_005345.5
RefSeq ORF Size:1926bp
cDNA Description:Full length Clone DNA of Homo sapiens heat shock 70kDa protein 1A with N terminal His tag.
Gene Synonym:HSP72, HSPA1, HSP70I, HSPA1B, HSP70-1, FLJ54303, FLJ54370, FLJ54392, FLJ54408, FLJ75127, HSP70-1A, HSPA1A
Species:Human
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

HSPA1A is a member of the Hsp70 protein family. The 70 kilodalton heat shock proteins (Hsp70s) are a family of ubiquitously expressed heat shock proteins. HSP are abundant and conserved proteins present in all cells. Upon temperature shock or other stress stimuli, HSP are synthesized intracellularly, which may protect cells from protein denaturation or from death. Extracellularly, HSP can serve a cytokine function to initiate both innate and adaptive immunity through activation of APC. HSP serves also a chaperone function and facilitates presentation of antigen peptide to T cells. Molecular chaperones of the Hsp70 family have diverse functions in cells. They assist the folding of newly synthesized and stress-denatured proteins, as well as the import of proteins into organelles, and the dissociation of aggregated proteins. The well-conserved Hsp70 chaperones are ATP dependent: binding and hydrolysis of ATP regulates their interactions with unfolded polypeptide substrates, and ATPase cycling is necessary for their function. All cellular functions of Hsp70 chaperones use the same mechanism of ATP-driven polypeptide binding and release. 

References
  • Heck TG, et al. (2011) HSP70 expression: does it a novel fatigue signalling factor from immune system to the brain Cell Biochem Funct. 29 (3): 215-26.
  • Chen T, et al. (2010) Stress for maintaining memory: HSP70 as a mobile messenger for innate and adaptive immunity. Eur J Immunol. 40 (6): 1541-4.
  • Young JC. (2010) Mechanisms of the Hsp70 chaperone system. Biochem Cell Biol. 88 (2): 291-300.
  • Size / Price
    Catalog: HG11660-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"