After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human STC2 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human STC2 cDNA Clone Product Information
Gene_bank_ref_id:BC000658
RefSeq ORF Size:909bp
cDNA Description:Full length Clone DNA of Homo sapiens stanniocalcin 2 with C terminal His tag.
Gene Synonym:STC-2, STCRP, STC2
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

STC2 is a secreted, homodimeric glycoprotein which expressed in a wide variety of tissues. STC2 has an anti-hypocalcemic action on calcium and phosphate homeostasis. It may have autocrine or paracrine functions. Its C-terminus contains a cluster of histidine residues which may interact with metal ions. STC2 has 10 of its 15 cysteine residues conserved among stanniocalcin family members and is phosphorylated by casein kinase 2 exclusively on its serine residues. It may play a role in the regulation of renal and intestinal calcium and phosphate transport, cell metabolism, or cellular calcium/phosphate homeostasis.

References
  • Chang AC, et al. (1998) Identification of a second stanniocalcin cDNA in mouse and human: stanniocalcin 2. Mol Cell Endocrinol. 141(1-2):95-9.
  • Ishibashi K, et al. (1998) Molecular cloning of a second human stanniocalcin homologue (STC2). Biochem Biophys Res Commun. 250(2):252-8.
  • uo CW, et al. (2005) Identification of a stanniocalcin paralog, stanniocalcin-2, in fish and the paracrine actions of stanniocalcin-2 in the mammalian ovary. Endocrinology. 146(1):469-76.
  • Size / Price
    Catalog: HG13653-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"