Quick Order

Human KLK-11 transcript variant 1 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human KLK11 cDNA Clone Product Information
NCBI RefSeq:NM_006853.2
RefSeq ORF Size:753bp
cDNA Description:Full length Clone DNA of Homo sapiens kallikrein-related peptidase 11 , transcript variant 1 with C terminal HA tag.
Gene Synonym:TLSP, PRSS20, MGC33060
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

kallikrein-related peptidase 11 (KLK11), also known as hippostasin, trypsin-like serine protease and PRSS20, is a member of human tissue kallikrein family. It is a subgroup of serine proteases with diverse physiological functions, which is implicated in carcinogenesis and some with potential that serving as novel biomarkers for ovarian and prostate cancer and other diseases. The KLK11 gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Two alternatively spliced forms exist, resulting in 250 (isoform 1) and 282 (isoform 2) amino acid sequences. Isoform 2 is identical to isoform 1, except for an inserted 32 amino acid segment. Isoform 1 is predominantly expressed in brain whereas isoform 2 is preferentially expressed in prostate.

Size / Price
Catalog: HG10767-CY
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"