Quick Order

Text Size:AAA

Human DCXR ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human DCXR cDNA Clone Product Information
Gene_bank_ref_id:BC001470
RefSeq ORF Size:735bp
cDNA Description:Full length Clone DNA of Homo sapiens dicarbonyl/L-xylulose reductase with N terminal Myc tag.
Gene Synonym:XR, DCR, HCR2, P34H, HCRII, KIDCR, SDR20C1
Species:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

DCXR, also known as HCR2, belongs to the short-chain dehydrogenases/reductases (SDR) family. It is highly expressed in kidney, liver and epididymis. In the epididymis, DCXR is mainly expressed in the proximal and distal sections of the corpus region. HCR2 is weakly or not expressed in brain, lung, heart, spleen and testis. DCXR catalyzes the NADPH-dependent reduction of several pentoses, tetroses, trioses, alpha-dicarbonyl compounds and L-xylulose. DCXR participates in the uronate cycle of glucose metabolism. It may play a role in the water absorption and cellular osmoregulation in the proximal renal tubules by producing xylitol, an osmolyte, thereby preventing osmolytic stress from occurring in the renal tubules.

References
  • Kim W, et al. (2011) Systematic and quantitative assessment of the ubiquitin-modified proteome. Mol Cell. 44(2):325-40.
  • Pierce SB, et al. (2011) Garrod's fourth inborn error of metabolism solved by the identification of mutations causing pentosuria. Proc Natl Acad Sci. 108(45):18313-7.
  • Udeshi ND, et al. (2012) Methods for quantification of in vivo changes in protein ubiquitination following proteasome and deubiquitinase inhibition. Mol Cell Proteomics. 11(5):148-59.
  • Size / Price
    Catalog: HG14562-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"