Quick Order

Human CRIPT ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CRIPT cDNA Clone Product Information
Gene_bank_ref_id:BC006980
RefSeq ORF Size:306bp
cDNA Description:Full length Clone DNA of Homo sapiens cysteine-rich PDZ-binding protein with N terminal Myc tag.
Gene Synonym:HSPC139
Species:Human
Vector:pCMV3-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

CRIPT, also known as cysteine-rich PDZ-binding protein, belongs to the CRIPT family. It interacts with TUBB1. CRIPT also interacts strongly with the PDZ3 domain of members of the DLG4 family. It is involved in the cytoskeletal anchoring of DLG4 in excitatory synapses. CRIPT is highly conserved from mammals to plants and binds selectively to the third PDZ domain (PDZ3) of PSD-95 via its C terminus. n heterologous cells, CRIPT causes a redistribution of PSD-95 to microtubules. In brain, CRIPT colocalizes with PSD-95 in the postsynaptic density and can be coimmunoprecipitated with PSD-95 and tubulin. These findings suggest that CRIPT may regulate PSD-95 interaction with a tubulin-based cytoskeleton in excitatory synapses.

References
  • Niethammer M. et al., 1998,Neuron. 20 (4): 693-707.
  • Passafaro M. et al., 2000, Nat Neurosci. 2 (12): 1063-9.
  • Piserchio A. et al., 2002, J Biol Chem. 277 (9): 6967-73.
  • Fukunaga Y. et al., 2005, J Biochem. 138 (2): 177-82.
  • Size / Price
    Catalog: HG14560-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"