Quick Order

Human SRGN Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SRGNcDNA Clone Product Information
Gene_bank_ref_id:BC015516
cDNA Size:477
cDNA Description:ORF Clone of Homo sapiens serglycin DNA.
Gene Synonym:PPG, PRG, PRG1, SRGN
Species:Human
Vector:pCMV3-C-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
 
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name
Background

SRGN is known as a hematopoietic cell granule proteoglycan. Proteoglycans stored in the secretory granules of various hematopoietic cells has a protease-resistant peptide core, and is vital for neutralizing hydrolytic enzymes. SRGN is associated with the macromolecular complex of granzymes and perforin, which may serve as a mediator of granule-mediated apoptosis. It is required for storage of some proteases in both connective tissue and mucosal mast cells and for storage of granzyme B in T-lymphocytes. SRGN also plays a role in localizing neutrophil elastase in azurophil granules of neutrophils.

References
  • Hatton MN. et al., 1985, Biochem J. 230 (3): 817-20.
  • Schick BP. et al., 1995, J Cell Physiol. 165 (1): 96-106.
  • Kato S. et al., 1995, Gene. 150 (2): 243-50.
  • Size / Price
    Catalog:HG13648-CH
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"