Quick Order

Human LUM ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human LUM cDNA Clone Product Information
Gene_bank_ref_id:NM_002345.3
RefSeq ORF Size:1017bp
cDNA Description:Full length Clone DNA of Homo sapiens lumican with N terminal His tag.
Gene Synonym:LDC, SLRR2D, LUM
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:pCMV3-His-LUM
Restriction Site:KpnI + NotI (6kb + 1.06kb)
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Lumican, a prototypic leucine-rich proteoglycan with keratan sulfate side chains, is a major component of the cornea, dermal, and muscle connective tissues. In these bifunctional molecules, the protein moiety binds collagen fibrils and the highly charged hydrophilic glycosaminoglycans regulate interfibrillar spacings. Lumican is the major keratan sulfate proteoglycan of the cornea but is also distributed in interstitial collagenous matrices throughout the body. Lumican regulates collagenous matrix assembly as a keratan sulfate proteoglycan in the cornea and is also present in the connective tissues of other organs and embryonic corneal stroma as a glycoprotein. Lumican may regulate collagen fibril organization and circumferential growth, corneal transparency, and epithelial cell migration and tissue repair. lumican expressed in injured epithelium may modulate cell behavior such as adhesion or migration, thus contributing to corneal epithelial wound healing. Lumican plays a crucial role in the regulation of collagen assembly into fibrils in various connective tissues and serve as a definitive link between a necessity for lumican in the development of a highly organized collagenous matrix and corneal transparency.

References
  • Saika S, et al. (2000) Role of lumican in the corneal epithelium during wound healing. J Biol Chem. 275(4): 2607-12.
  • Chakravarti S, et al. (1998) Lumican regulates collagen fibril assembly: skin fragility and corneal opacity in the absence of lumican. J Cell Biol. 141(5): 1277-86.
  • Ezura Y, et al. (2000) Differential expression of lumican and fibromodulin regulate collagen fibrillogenesis in developing mouse tendons. J Cell Biol. 151(4): 779-88.
  • Size / Price
    Catalog: HG11640-NH
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn StockShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"