Quick Order

Human PTRH2 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PTRH2 cDNA Clone Product Information
Gene_bank_ref_id:BC006807
RefSeq ORF Size:540bp
cDNA Description:Full length Clone DNA of Homo sapiens peptidyl-tRNA hydrolase 2 with C terminal His tag.
Gene Synonym:BIT1, PTH2, CGI-147, PTRH2
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

PTH2, also known as PTRH2, is a mitochondrial protein which belongs to the PTH2 family. PTH 2 is released during apoptosis from the mitochondria to the cytoplasm. The natural substrate for PTH 2 may be peptidyl-tRNAs which drop off the ribosome during protein synthesis. When in the cytoplasm, PTRH2 regulates the function of 2 transcriptional regulators, TLE5 and TLE1, thus promoting caspase-independent cell death.

References
  • Prahalad AK. et al., 2006, Proteomics. 6 (12): 3482-93.
  • Jin L. et al., 2000, J Biol Chem. 275 (35): 27238-44.
  • Boone T. et al., 2000, Nat Struct Biol. 7 (6): 486-91.
  • Size / Price
    Catalog: HG13645-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"