After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human REG1B ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human REG1B cDNA Clone Product Information
NCBI RefSeq:NM_006507.3
RefSeq ORF Size:501bp
cDNA Description:Full length Clone DNA of Homo sapiens regenerating islet-derived 1 beta with N terminal His tag.
Gene Synonym:REGH, REGL, PSPS2, REGI-BETA, REG1B
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Regenerating gene (Reg), first isolated from a regenerating islet cDNA library, encodes a secretory protein with a growth stimulating effect on pancreatic beta cells, and could be associated with fibrocalculous pancreatopathy. Reg and Reg-related genes which were expressed in various organs have been revealed to constitute a multigene family, the Reg family consisting of four subtypes (types I, II, III, IV) and are involved in cancers and neurodegenerative diseases. Regenerating islet-derived 1 beta (REG1B), also known as Lithostathine-1-beta and Pancreatic stone protein 2 (PSPS2), is a types I Reg protein and contains one typical C-type lectin domain. REG1B is a 166-amino acid protein which has 22 amino acid substitutions in comparison with the previously isolated human REG1A, and it is was expressed only in pancreas. REG1B Is normally found in the exocrine pancreas, whereas in other tissues it appears either only under pathological conditions, such as Alzheimer's disease (brain), cancer (colon), or during regeneration such as neuronal sprouting in brain and pancreas regeneration. REG1B might act as an inhibitor of spontaneous calcium carbonate precipitation. The REG1A and REG1B gene and proteins could play different roles in the pancreas.

References
  • Moriizumi S, et al. (1994) Isolation, structural determination and expression of a novel reg gene, human regI beta. Biochim Biophys Acta. 1217(2): 199-202.
  • Sanchez D, et al. (2001) Preferential expression of reg I beta gene in human adult pancreas. Biochem Biophys Res Commun. 284(3): 729-37.
  • Boonyasrisawat W, et al. (2002) Analysis of the reg1alpha and reg1beta gene transcripts in patients with fibrocalculous pancreatopathy. Southeast Asian J Trop Med Public Health. 33(2): 365-72.
  • Size / Price
    Catalog: HG11638-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"