After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human NCKIPSD Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
NCKIPSDcDNA Clone Product Information
cDNA Size:2148
cDNA Description:ORF Clone of Homo sapiens NCK interacting protein with SH3 domain DNA.
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Human NCKIPSD Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged on other vectors
Related Products
Product nameProduct name

NCKIPSD is localized exclusively in the cell nucleus. It plays a role in signal transduction, and may function in the maintenance of sarcomeres and in the assembly of myofibrils into sarcomeres. NCKIPSD also plays an important role in stress fiber formation. NCKIPSD gene is involved in therapy-related leukemia by a chromosomal translocation t(3;11)(p21;q23) that involves this gene and the myeloid/lymphoid leukemia gene. Alternative splicing occurs in this locus and two transcript variants encoding distinct isoforms have been identified. NCKIPSD is a SH3 domain protein. Fas ligand is a cytotoxic effector molecule of T and NK cells which is characterized by an intracellular N-terminal polyproline region that serves as a docking site for SH3 and WW domain proteins. Several previously described Fas ligand-interacting SH3 domain proteins turned out to be crucial for the regulation of storage, expression and function of the death factor. Recent observations, however, indicate that Fas ligand is also subject to posttranslational modifications including shedding and intramembrane proteolysis.

  • Satoh, S, et al. (2001) mDia-interacting protein acts downstream of Rho-mDia and modifies Src activation and stress fiber formation. J Biol Chem. 276(42):39290-4.
  • de Bernard M, et al. (2000) The VacA toxin of Helicobacter pylori identifies a new intermediate filament-interacting protein. EMBO J. 19(1):48-56.
  • Sano K, et al. (2000) Novel SH3 protein encoded by the AF3p21 gene is fused to the mixed lineage leukemia protein in a therapy-related leukemia with t(3;11) (p21;q23). Blood. 95(3): 1066-8.
  • Voss M, et al. (2009) Identification of SH3 domain interaction partners of human FasL (CD178) by phage display screening. BMC Immunol. 10:53.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items