After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human BMF ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human BMF cDNA Clone Product Information
Gene_bank_ref_id:NM_001003940.1
RefSeq ORF Size:555bp
cDNA Description:Full length Clone DNA of Homo sapiens Bcl2 modifying factor with C terminal His tag.
Gene Synonym:BMF
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

BMF(Bcl2 modifying factor) belongs to the BCL2 protein family. BCL2 family members form hetero- or homodimers and act as anti- or pro-apoptotic regulators that are involved in a wide variety of cellular activities. BMF contains a single BCL2 homology domain 3 (BH3), and has been shown to bind BCL2 proteins and function as an apoptotic activator. BMF is found to be sequestered to myosin V motors by its association with dynein light chain 2, which may be important for sensing intracellular damage and triggering apoptosis. Alternatively spliced transcript variants encoding different isoforms have been identified.

References
  • Hattori A, et al. (2001) Characterization of long cDNA clones from human adult spleen. DNA Res. 7(6):357-66.
  • Day Catherine L, et al. (2004) Localization of dynein light chains 1 and 2 and their pro-apoptotic ligands. Biochem J. 377(Pt 3):597-605.
  • Puthalakath H, et al. (2001) Bmf: a proapoptotic BH3-only protein regulated by interaction with the myosin V actin motor complex, activated by anoikis. Science. 293(5536):1829-32.
  • Size / Price
    Catalog: HG13639-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"