After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Cynomolgus monkey PLXDC1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PLXDC1cDNA Clone Product Information
Gene_bank_ref_id:XM_005583997.1
cDNA Size:1503
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) plexin domain containing 1 DNA.
Gene Synonym:PLXDC1
Species:Cynomolgus
Vector:pCMV3-N-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name
Background

Plexin domain-containing protein 1, also known as tumor endothelial marker 3, tumor endothelial marker 7 and PLXDC1 and TEM3, is a secreted, cytoplasm and single-pass type I membrane protein which belongs to the plexin family. PLXDC1 / TEM3 is detected in endothelial cells from colorectal cancer, and in endothelial cells from primary cancers of the lung, liver, pancreas, breast and brain. It is expressed in fibrovascular membrane with increased expression in individuals with proliferative diabetic retinopathy. PLXDC1 / TEM3 is not detectable in endothelial cells from normal tissue. PLXDC1 / TEM3 plays a critical role in endothelial cell capillary morphogenesis. PLXDC1 / TEM3 may play a significant role in the proliferation and maintenance of neovascular endothelial cells in the formation of fibrovascular membranes (FVMs). PLXDC1 / TEM3 may be a molecular target for new diagnostic and therapeutic strategies for proliferative diabetic retinopathy (PDR). PLXDC1 / TEM3 interacts with NID1. It may also interact with CTTN.

References
  • Beaty,R.M. et al., 2007,J Neurooncol. 81 (3):241-8.
  • Miller,S.F. et al., 2007, Gene Expr Patterns. 7 (5):635-44.
  • Yamaji,Y. et al., 2008, Invest Ophthalmol Vis Sci. 49 (7):3151-7.
  • Size / Price
    Catalog:CG90635-NY
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"