After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human CLPS Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CLPScDNA Clone Product Information
cDNA Size:339
cDNA Description:ORF Clone of Homo sapiens colipase, pancreatic DNA.
Gene Synonym:CLPS
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

Colipase belongs to the colipase family. Structural studies of the complex and of colipase alone have revealed the functionality of its architecture. It is a small protein with five conserved disulphide bonds. Structural analogies have been recognised between a developmental protein, the pancreatic lipase C-terminal domain, the N-terminal domains of lipoxygenases and the C-terminal domain of alpha-toxin. Colipase can only be detected in pancreatic acinar cells, suggesting regulation of expression by tissue-specific elements. Colipase allows lipase to anchor noncovalently to the surface of lipid micelles, counteracting the destabilizing influence of intestinal bile salts. Without colipase the enzyme is washed off by bile salts, which have an inhibitory effect on the lipase. Colipase is a cofactor needed by pancreatic lipase for efficient dietary lipid hydrolysis. It binds to the C-terminal, non-catalytic domain of lipase, thereby stabilising as active conformation and considerably increasing the overall hydrophobic binding site.

  • Davis RC, et al. (1991) Assignment of the human pancreatic colipase gene to chromosome 6p21.1 to pter. Genomics. 10(1):262-5.
  • Lowe ME. (1997) Structure and function of pancreatic lipase and colipase. Annu Rev Nutr. 17: 141-58.
  • Verger R, et al. (1999) Colipase: structure and interaction with pancreatic lipase. Biochim Biophys Acta. 1441(2-3):173-84.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items