Quick Order

Text Size:AAA

Influenza A H11N6 (A/duck/England/1/1956) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized)

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
H11N6 HA cDNA Clone Product Information
RefSeq ORF Size:1698bp
cDNA Description:Full length Clone DNA of Influenza A H11N6 (A/duck/England/1/1956) Hemagglutinin DNA.
Gene Synonym:Hemagglutinin, HA
Restriction Site:KpnI + XbaI (5.5kb + 1.7kb)
Tag Sequence:
Sequence Description:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with AGB50949.1.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Influenza A H11N6 (A/duck/England/1/1956) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized) on other vectors
Product nameProduct name
Size / Price
Catalog: VG40188-G-N
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions