Quick Order

Human NME1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
NME1cDNA Clone Product Information
Gene_bank_ref_id:NM_000269.2
cDNA Size:459
cDNA Description:ORF Clone of Homo sapiens non-metastatic cells 1, protein (NM23A) expressed in DNA.
Gene Synonym:NB, AWD, NBS, GAAD, NM23, NDPKA, NDPK-A, NM23-H1, NME1
Species:Human
Vector:pCMV3-N-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-His Vector Information
 
Vector Name pCMV3-N-His
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-N-His Physical Map

Schematic of pCMV3-N-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name
Background

NME1, also known as Nucleoside Diphosphate Kinase A (NDK-A), or NM23-H1, belongs to the NDK family. NM23-H1 is known to have a metastasis suppressive activity in many tumor cells. Recent studies have shown that the interacting proteins with NM23-H1 which mediate the cell proliferation, may act as modulators of the metastasis suppressor activity. The interacting proteins with NM23-H1 can be classified into 3 groups. The first group of proteins can be classified as upstream kinases of NM23-H1 such as CKI and Aurora-A/STK15. The second group of proteins acts as downstream effectors for the regulation of specific gene transcriptions, GTP-binding protein functions, and signal transduction in Erk signal cascade. The third group of proteins can be classified as bi-directionally influencing binding partners of NM23-H1. As a result, the interactions with NM23-H1 and binding partners have implications in the biochemical characterization involved in metastasis and tumorigenesis. NDKA is increased in human postmortem cerebrospinal fluid (CSF), a model of global brain insult, suggesting that measurement in CSF and, more importantly, in plasma may be useful as a biomarker of stroke. Additionally, NM23-H1 significantly reduces metastasis without effects on primary tumor size and was the first discovered metastasis suppressor gene.

References
  • Allard L, et al. (2005) PARK7 and nucleoside diphosphate kinase A as plasma markers for the early diagnosis of stroke. Clin Chem. 51(11): 2043-51.
  • Steeg PS, et al. (2008) Clinical-translational approaches to the Nm23-H1 metastasis suppressor. Clin Cancer Res. 14(16): 5006-12.
  • Kim HD, et al. (2009) Regulators affecting the metastasis suppressor activity of Nm23-H1. Mol Cell Biochem. 329(1-2): 167-73.
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"