After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human LRAP / ERAP2 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ERAP2 cDNA Clone Product Information
Gene_bank_ref_id:NM_022350.3
RefSeq ORF Size:2883bp
cDNA Description:Full length Clone DNA of Homo sapiens endoplasmic reticulum aminopeptidase 2 with C terminal HA tag.
Gene Synonym:LRAP, L-RAP, FLJ23633, FLJ23701, FLJ23807, ERAP2
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Leukocyte-derived arginine aminopeptidase (LRAP), also known as endoplasmic reticulum-aminopeptidase 2 (ERAP2), is the second identified aminopeptidase localized in the in the lumenal side of endoplasmic reticulum (ER) processing antigenic peptides presented to major histocompatibility complex (MHC) class I molecules. It is a 960-amino acid protein with significant homology to placental leucine aminopeptidase and adipocyte-derived leucine aminopeptidase. LRAP preferentially hydrolyzes the basic residues Arg and Lys, and contains the HEXXH(X)18E zinc-binding motif, which is the characteristic of the M1 family of zinc metallopeptidases which also includes PILS/ARTS1/ERAP1 and LNPEP/PLAP. Induced by interferon-gamma, LRAP is able to trim various MHC class I antigenic peptide precursors.

Size / Price
Catalog: HG10734-CY
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"