Quick Order

Human CPLX3 ORF mammalian expression plasmid, N-Myc tag

DatasheetReviewsRelated ProductsProtocols
Human CPLX3 cDNA Clone Product Information
NCBI RefSeq:BC018026
RefSeq ORF Size:477bp
cDNA Description:Full length Clone DNA of Homo sapiens complexin 3 with N terminal Myc tag.
Gene Synonym:CPXIII, CPX-III, Nbla11589
Species:Human
Vector:pCMV3-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

CPLX3, also known as complexin 3, belongs to the complexin/synaphin family. As a SNARE-binding protein, complexin (CPX), can act either as a facilitator or as an inhibitor of membrane fusion, constituting a controversial dilemma. CPX acts sequentially on assembling SNAREpins, first facilitating zippering by nearly doubling the distance at which v- and t-SNAREs can engage and then clamping them into a half-zippered fusion-incompetent state. Specifically, the central helix of CPX allows SNAREs to form this intermediate energetic state at 9-15 nm but not when the bilayers are closer than 9 nm. Stabilizing the activated-clamped state at separations of less than 9 nm requires the accessory helix of CPX, which prevents membrane-proximal assembly of SNAREpins. CPLX3 binds to the SNARE core complex containing SNAP25, VAMP2 and STX1A.

References
  • Newton-Cheh C. et al., 2009, Nat Genet. 41(6): 666-76.
  • Li F. et al., 2011, Nat Struct Mol Biol. 18 (8): 941-6.
  • Amin N. et al., 2012, Mol Psychiatry. 17 (11): 1116-29.
  • Size / Price
    Catalog: HG14518-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"