After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human PRSS7 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human TMPRSS15 cDNA Clone Product Information
Gene_bank_ref_id:NM_002772.1
RefSeq ORF Size:3060bp
cDNA Description:Full length Clone DNA of Homo sapiens protease, serine, 7 (enterokinase) with C terminal HA tag.
Gene Synonym:ENTK, MGC133046, PRSS7
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Enterokinase, or Enteropeptidase is a type II transmembrane, which is a member of the trypsin family of serine proteases, and plays a key role in mammalian metabolism. It is synthesized as a zymogen (proenteropeptidase) that requires activation by another protease, either trypsin or possibly duodenase. Active enteropeptidase then converts the pancreatic precursor, trypsinogen, to trypsin by cleavage of the specific trypsinogen activation peptide, Asp-Asp-Asp-Asp-Lys- Ile that is highly conserved in vertebrates. The mature trypsin in turn activates other proenzymes including chymotrypsinogen, procarboxypeptidases, and proelastases. Enterokinase consists of two subunits linked by a disulfide bond. The heavy chain achors enterokinase in the intestinal brush border membrane and the light chain is the catalytic subunit, which has the same mechanism of action as trypsin and chymotrypsin. Enterokinase is the physiological activator of trypsinogen and has a specificity for the sequence (Asp)4-Lys-Ile. Because of its high specificity towards the amino acid sequence (Asp)(4)-Lys, enterokinase is a potential tool for the cleavage of fusion proteins, which are gaining more importance in biopharmaceutical production. In addition, Enterokinase is a tool protease widely utilized in the cleavage of recombinant fusion proteins.

References
  • Light A, et al. (1989) Enterokinase (enteropeptidase): comparative aspects. Trends Biochem Sci. 14(3): 110-2.
  • Kubitzki T, et al. (2009) Application of immobilized bovine enterokinase in repetitive fusion protein cleavage for the production of mucin 1. Biotechnol J. 4(11): 1610-8.
  • Zheng XL, et al. (2009) Enteropeptidase, a type II transmembrane serine protease. Front Biosci (Elite Ed). 1: 242-9.
  • Size / Price
    Catalog: HG10733-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"