After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human DCBLD2 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human DCBLD2 cDNA Clone Product Information
Gene_bank_ref_id:BC029658
RefSeq ORF Size:2232bp
cDNA Description:Full length Clone DNA of Homo sapiens discoidin, CUB and LCCL domain containing 2 with C terminal His tag.
Gene Synonym:ESDN, CLCP1, DCBLD2
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

DCBLD2, also known as ESDN and CLCP1, localizes in various compartments. DCBLD2 is up-regulated in lung cancers and is regulated by transcription factor AP-2 alpha (TFAP2A), a component of activator protein-2 (AP-2) that is known to regulate IL-8 production in human lung fibroblasts and epithelial cells. DCBLD2 could be related to FEV(1)-related phenotypes in asthmatics. DCBLD2 gene is expressed at very high level. DCBLD2 is proposed to participate in processes such as intracellular receptor mediated signaling pathway, negative regulation of cell growth and so on.

References
  • Kobuke K. et al., 2001, J Biol Chem. 276 (36): 34105-14.
  • Adeghi MM. et al., 2007, Am J Transplant. 7 (9): 2098-105.
  • Chen Y. et al., 2007, Proteomics. 7 (14): 2384-97.
  • Park TJ. et al., 2012, J Korean Med Sci. 27 (4): 343-9.
  • Size / Price
    Catalog: HG13615-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"