Quick Order

Human IDO2 ORF mammalian expression plasmid (Codon Optimized), C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human IDO2 cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:1224bp
cDNA Description:Full length Clone DNA of Homo sapiens indoleamine 2,3-dioxygenase 2 with C terminal His tag.
Gene Synonym:INDOL1, IDO2
Species:Human
Vector:pCMV3-C-His
Plasmid:pCMV3-IDO2-His
Restriction Site:KpnI + XbaI (6kb + 1.27kb)
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

IDO2 belongs to the indoleamine 2,3-dioxygenase family. Indoleamine 2,3-dioxgyenase (IDO), is a cytosolic haem protein which, together with the hepatic enzyme tryptophan 2,3-dioxygenase, catalyzes the conversion of tryptophan and other indole derivatives to kynurenines. In addition to classic IDO (IDO1), a new variant, IDO2, has recently been described. IDO2 is expressed in liver, small intestine, spleen, placenta, thymus, lung, brain, kidney, and colon. IDO is widely distributed in human tissues, its physiological role is not fully understood but is of great interest. IDO can be up-regulated via cytokines such as interferon-gamma, and can thereby modulate the levels of tryptophan, which is vital for cell growth. In humans and mice, the IDO1 and IDO2 genes are present tandemly in a tail-to-head arrangment on chromosome 8. In lower vertebrates such as zebrafish and toads only a single IDO gene may be present that may be more IDO2-like in structure. This closer relationship to IDO2 suggests that IDO2 may actually be the ancestor of the better characterized IDO1 gene, and that IDO1 might have been generated by gene duplication of IDO2 before the origin of tetrapods in mammalian evolutionary history. IDO2 catalyzes the first and rate-limiting step in the kynurenine pathway of tryptophan catabolism.

References
  • Witkiewicz AK, et al. (2009) Genotyping and expression analysis of IDO2 in human pancreatic cancer: a novel, active target. J Am Coll Surg. 208 (5): 781-7.
  • Sorensen RB, et al. (2011) Spontaneous cytotoxic T-Cell reactivity against indoleamine 2,3-dioxygenase-2. Cancer Res. 71 (6): 2038-44.
  • Witkiewicz AK, et al. (2009) Genotyping and expression analysis of IDO2 in human pancreatic cancer: a novel, active target. J Am Coll Surg. 208 (5): 781-7.
  • Size / Price
    Catalog: HG13614-CH
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"