Quick Order

Human DYRK3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
DYRK3cDNA Clone Product Information
Gene_bank_ref_id:NM_003582.2
cDNA Size:1767
cDNA Description:ORF Clone of Homo sapiens dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3 DNA.
Gene Synonym:RED, REDK, DYRK5, hYAK3-2, DYRK3
Species:Human
Vector:pCMV3-C-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
 
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Human DYRK3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged on other vectors
Human DYRK3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10726-ACG$345
Human DYRK3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10726-ACR$345
Human DYRK3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10726-ANG$345
Human DYRK3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10726-ANR$345
Human DYRK3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10726-CF$315
Human DYRK3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10726-CH$315
Human DYRK3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10726-CM$315
Human DYRK3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10726-CY$315
Human DYRK3 Gene cDNA Clone (full-length ORF Clone)HG10726-M$195
Human DYRK3 Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-taggedHG10726-M-F$395
Human DYRK3 Gene cDNA Clone (full-length ORF Clone) expression ready, untaggedHG10726-M-N$395
Human DYRK3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10726-NF$315
Human DYRK3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10726-NH$315
Human DYRK3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10726-NM$315
Human DYRK3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10726-NY$315
Human DYRK3 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10726-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

Dual specificity tyrosine-phosphorylation-regulated kinase 3, also known as Regulatory erythroid kinase, REDK and DYRK3, is a nucleus protein which belongs to the protein kinase superfamily, CMGC Ser/Thr protein kinase family and MNB/DYRK subfamily. DYRKs are an emerging family of dual-specificity kinases that play key roles in cell proliferation, survival, and development. DYRK3 contains one protein kinase domain. Isoform 1 and isoform 2 of DYRK3 are highly expressed in testis and in hematopoietic tissue such as fetal liver, and bone marrow. Isoform 2 of DYRK3 is the predominant form in testis. Isoform 1 of DYRK3 is the predominant form in fetal liver and bone marrow. Isoform 1 and isoform 2 are present at low levels in heart, pancreas, lymph node, and thymus. DYRK3 is a negative regulator of EPO-dependent erythropoiesis. It may place an upper limit on red cell production during stress erythropoiesis. DYRK3 inhibits cell death due to cytokine withdrawal in hematopoietic progenitor cells. It may also act by regulating CREB/CRE signaling. DYRK3 proved to effectively inhibit NFAT (nuclear factor of activated T cells) transcriptional response pathways and to co-immunoprecipitate with NFATc3. DYRK3 attenuates (and possibly apportions) red cell production selectively during anemia.

References
  • Becker W., et al., 1998, J. Biol. Chem. 273: 25893-25902.
  • Himpel,S. et al., 2000,J Biol Chem  275 (4):2431-8.
  • Li,K. et al., 2002, J Biol Chem. 277 (49):47052-60.
  • Bogacheva,O. et al., 2008, J Biol Chem. 283 (52):36665-75.
  • Guo,X. et al., 2010, J Biol Chem.285 (17):13223-32.
  • Size / Price
    Catalog:HG10726-CY
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"