After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human PDE1C Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific PreferencesReviewsResearch TopicsProtocols
PDE1CcDNA Clone Product Information
Gene Bank Ref.ID:BC022479
cDNA Size:1905
cDNA Description:ORF Clone of Homo sapiens phosphodiesterase 1C, calmodulin-dependent 70kDa DNA.
Gene Synonym:Hcam3, PDE1C
Species:Human
Vector:pCMV3-C-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping Carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
 
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

PDE1C belongs to the cyclic nucleotide phosphodiesterase family, PDE1 subfamily. Phosphodiesterases (PDEs) are a family of related phosphohydrolyases that selectively catalyze the hydrolysis of 3' cyclic phosphate bonds in adenosine and/or guanine 3',5' cyclic monophosphate (cAMP and/or cGMP). They regulate the cellular levels, localization and duration of action of these second messengers by controlling the rate of their degradation. PDEs are expressed ubiquitously, with each subtype having a specific tissue distribution. These enzymes are involved in many signal transduction pathways and their functions include vascular smooth muscle proliferation and contraction, cardiac contractility, platelet aggregation, hormone secretion, immune cell activation, and they are involved in learning and memory. PDE1C has a high affinity for both cAMP and cGMP. It is expressed in several tissues, including brain and heart. As a cyclic nucleotide phosphodiesterase, PDE1C has a dual-specificity for the second messengers cAMP and cGMP.

Reference
  • Strausberg RL, et al. (2003) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • Dolci S, et al. (2006) Subcellular localization and regulation of type-1C and type-5 phosphodiesterases. Biochem Biophys Res Commun. 341(3):837-46.
  • Vandeput F, et al.. (2007) Cyclic nucleotide phosphodiesterase PDE1C1 in human cardiac myocytes. Biochemistry. J Biol Chem. 282(45):32749-57.
  • Size / Price
    Catalog:HG13605-CH
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availsability:2-3 weeks
    Images
      Please note:All products are "FOR RESEARCH UES ONLY AND ARE NOT INTENDED FOR DIAGNOSTICE OFR THERAPEUTIC USE"