After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human APP / PN2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
APPcDNA Clone Product Information
Gene_bank_ref_id:NM_201413.1
cDNA Size:2256
cDNA Description:ORF Clone of Homo sapiens amyloid beta (A4) precursor protein (APP), transcript variant 2 DNA.
Gene Synonym:APP, AAA, AD1, PN2, ABPP, APPI, CVAP, ABETA, CTFgamma
Species:Human
Vector:pCMV3-C-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
 
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Human APP / PN2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged on other vectors
Human APP / PN2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10703-ACG$345
Human APP / PN2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10703-ACR$345
Human APP / PN2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10703-CF$315
Human APP / PN2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10703-CH$315
Human APP / PN2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10703-CM$315
Human APP / PN2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10703-CY$315
Human APP / PN2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone)HG10703-M$115
Human APP / PN2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG10703-M-F$345
Human APP / PN2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10703-NF$315
Human APP / PN2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10703-NH$315
Human APP / PN2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10703-NM$315
Human APP / PN2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10703-NY$315
Human APP / PN2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10703-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

Amyloid precursor protein (APP) is a type I transmembrane protein expressed in many tissues and concentrated in the synapses of neurons, and is suggested as a regulator of synapse formation and neural plasticity. APP can be processed by two different proteolytic pathways. In one pathway, APP is cleaved by β- and γ-secretase to produce the amyloid-β-protein (Aβ, Abeta, beta-amyloid) which is the principal component of the amyloid plaques, the major pathological hallmark of Alzheimer’s disease (AD), while in the other pathway, α-secretase is involved in the cleavage of APP whose product exerts antiamyloidogenic effect and prevention of the Aβ peptide formation. The aberrant accumulation of aggregated beta-amyloid peptides (Abeta) as plaques is a hallmark of AD neuropathology and reduction of Abeta has become a leading direction of emerging experimental therapies for the disease. Besides this pathological function of Abeta, recently published data reveal that Abeta also has an essential physiological role in lipid homeostasis. Cholesterol increases Abeta production, and conversely A beta production causes a decrease in cholesterol synthesis. Abeta may be part of a mechanism controlling synaptic activity, acting as a positive regulator presynaptically and a negative regulator postsynaptically. The pathological accumulation of oligomeric Abeta assemblies depresses excitatory transmission at the synaptic level, but also triggers aberrant patterns of neuronal circuit activity and epileptiform discharges at the network level. Abeta-induced dysfunction of inhibitory interneurons likely increases synchrony among excitatory principal cells and contributes to the destabilization of neuronal networks. There is evidence that beta-amyloid can impair blood vessel function. Vascular beta-amyloid deposition, also known as cerebral amyloid angiopathy, is associated with vascular dysfunction in animal and human studies. Alzheimer disease is associated with morphological changes in capillary networks, and soluble beta-amyloid produces abnormal vascular responses to physiological and pharmacological stimuli.

References
  • Grimm MO, et al. (2007) Amyloid beta as a regulator of lipid homeostasis. Trends Mol Med. 13(8): 337-44.
  • Smith EE, et al. (2009) Beta-amyloid, blood vessels, and brain function. Stroke. 40(7): 2601-6.
  • Gouras GK, et al. (2010) Intraneuronal beta-amyloid accumulation and synapse pathology in Alzheimer's disease. Acta Neuropathol. 119(5): 523-41.
  • Palop JJ, et al. (2010) Amyloid-beta-induced neuronal dysfunction in Alzheimer's disease: from synapses toward neural networks. Nat Neurosci. 13(7): 812-8.
  • Size / Price
    Catalog:HG10703-CY
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"