Quick Order

Human EpCAM / TROP1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
EPCAMcDNA Clone Product Information
Gene_bank_ref_id:NM_002354.2
cDNA Size:945
cDNA Description:ORF Clone of Homo sapiens tumor-associated calcium signal transducer 1 DNA.
Gene Synonym:TACSTD1, EGP, KSA, M4S1, MK-1, CD326, EGP40, MIC18, TROP1, Ep-CAM, hEGP-2, CO17-1A, GA733-2??
Species:Human
Vector:pCMV3-C-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
 
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Human EpCAM / TROP1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged on other vectors
Human EpCAM / TROP1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10694-ACG$325
Human EpCAM / TROP1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10694-ACR$325
Human EpCAM / TROP1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10694-CF$295
Human EpCAM / TROP1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10694-CH$295
Human EpCAM / TROP1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10694-CM$295
Human EpCAM / TROP1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10694-CY$295
Human EPCAM Gene cDNA Clone (full-length ORF Clone)HG10694-G$95
Human EpCAM / TROP1 Gene cDNA Clone (full-length ORF Clone), expression ready, His-taggedHG10694-G-H$295
Human EpCAM / TROP1 Gene cDNA Clone (full-length ORF Clone) expression ready, Myc-taggedHG10694-G-M$295
Human EpCAM / TROP1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10694-G-N$295
Human EpCAM / TROP1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10694-NF$295
Human EpCAM / TROP1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10694-NH$295
Human EpCAM / TROP1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10694-NM$295
Human EpCAM / TROP1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10694-NY$295
Human EpCAM / TROP1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10694-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

Epithelial Cell Adhesion Molecule (EpCAM), also known as GA733-2 antigen, is a type â… transmembrane glycoprotein composed of an extracellular domain with two EGF-Like repeats and a cystenin-rich region, a transmembrane domain and a cytoplasmic domain. It modulates cell adhesion and proliferation. Its overexpression has been detected in many epithelial tumours and has been associated with high stage, high grade and a worse survival in some tumour types. EpCAM has been shown to function as a calcium-independent homophilic cell adhesion molecule that does not exhibit any obvious relationship to the four known cell adhesion molecule superfamilies. However, recent insights have revealed that EpCAM participates in not only cell adhesion, but also in proliferation, migration and differentiation of cells. In addition, recent study revealed that EpCAM is the Wnt-beta-catenin signaling target gene and may be used to facilitate prognosis. It has oncogenic potential and is activated by release of its intracellular domain, which can signal into the cell nucleus by engagement of elements of the wnt pathway.

References
  • Brunner A, et al. (2008) EpCAM is predominantly expressed in high grade and advanced stage urothelial carcinoma of the bladder. J Clin Pathol. 61(3):307-10.
  • Trzpis M, et al. (2008) EpCAM in morphogenesis. Front Biosci. 13: 5050-5.
  • Munz M, et al. (2009) The emerging role of EpCAM in cancer and stem cell signaling. Cancer Res. 69(14): 5627-9.
  • Carpenter G, et al. (2009) EpCAM: another surface-to-nucleus missile. Cancer Cell. 15(3): 165-6.
  • Size / Price
    Catalog:HG10694-CY
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"