After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human NLK ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human NLK cDNA Clone Product Information
Gene_bank_ref_id:NM_002946.3
RefSeq ORF Size:1584bp
cDNA Description:Full length Clone DNA of Homo sapiens nemo-like kinase with N terminal His tag.
Gene Synonym:FLJ21033, DKFZp761G1211, NLK
Species:Human
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Nemo-like kinase contains 1 protein kinase domain and belongs to the protein kinase superfamily, CMGC Ser/Thr protein kinase family and MAP kinase subfamily. It also contains a TQE activation loop motif in which autophosphorylation of the threonine residue (Thr-298) is sufficient for kinase activation. As a serine/threonine-protein kinase, nemo-like kinase regulates a number of transcription factors with key roles in cell fate determination. It is a positive effector of the non-canonical Wnt signaling pathway, acting downstream of WNT5A, MAP3K7/TAK1 and HIPK2. Activation of this pathway causes binding to and phosphorylation of the histone methyltransferase SETDB1. The NLK-SETDB1 complex subsequently interacts with PPARG, leading to methylation of PPARG target promoters at histone H3K9 and transcriptional silencing. The resulting loss of PPARG target gene transcription inhibits adipogenesis and promotes osteoblastogenesis in mesenchymal stem cells (MSCs). Nemo-like kinase also is a negative regulator of the canonical Wnt/beta-catenin signaling pathway.

References
  • Smit L, et al. (2004) Wnt activates the Tak1/Nemo-like kinase pathway. J Biol Chem. 279(17): 17232-40.
  • Yasuda J, et al. (2004) Nemo-like kinase suppresses a wide range of transcription factors, including nuclear factor-kappaB. Cancer Sci. 95(1):52-7.
  • Yasuda J, et al. (2003) Nemo-like kinase induces apoptosis in DLD-1 human colon cancer cells. Biochem Biophys Res Commun. 308(2):227-335.
  • Ishitani T, et al. (2003) Regulation of lymphoid enhancer factor 1/T-cell factor by mitogen-activated protein kinase-related Nemo-like kinase-dependent phosphorylation in Wnt/beta-catenin signaling. Mol Cell Biol. 23(4):1379-89.
  • Size / Price
    Catalog: HG11573-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"