Quick Order

Text Size:AAA

Human CST1 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CST1 cDNA Clone Product Information
Gene_bank_ref_id:NM_001898.2
RefSeq ORF Size:426bp
cDNA Description:Full length Clone DNA of Homo sapiens cystatin SN with N terminal His tag.
Gene Synonym:CST1
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Cystatin-SN, also known as Cystain-SA-I, Cystatin-1, Salivary cystatin-SA-1 and CST1, is a secreted protein which belongs to the cystatin family. The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. Cystatin-SN / CST1 is expressed in submandibular and sublingual saliva but not in parotid saliva (at protein level). Cystatin-SN / CST1 is also expressed in saliva, tears, urine and seminal fluid. Human saliva appears to contain several cysteine proteinase inhibitors that are immunologically related to cystatin S but that differ in their specificity due to amino acid sequence differences. Human salivary cystatins include Cystatin-S, Cystatin-S1, Cystatin-S2, Cystatin- SA, Cystatin-SN, Cystatin-C and Cystatin-D. Cystatin-SN is a much better inhibitor of papain and dipeptidyl peptidase I than is cystatin-S, although both inhibit ficin equally well.

Size / Price
Catalog: HG11568-NH
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"